View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9910_low_9 (Length: 399)
Name: NF9910_low_9
Description: NF9910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9910_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 374; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 4 - 389
Target Start/End: Complemental strand, 15662324 - 15661939
Alignment:
| Q |
4 |
attgcaactggggtgttttcagctgcatttagcttaccaggtggaaacaatgataacacagaatctcctaattatttagataagcctgcattcctcgtat |
103 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15662324 |
attgcaactggagtgttttcagctgcatttagcttaccaggtggaaacaatgataacaaagaatctcctaattatttagataaacctgcattcctcgtat |
15662225 |
T |
|
| Q |
104 |
ttgctttatccgactccatggcacttatctcgtcttcaacttcaatcttgatatttctatccatccttatctcgcgatatgcggagcaagattttctcaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15662224 |
ttgctttatccgactccatggcacttatctcgtcttcaacttcaatcttgatatttctatccatccttatctcgcgatatgcggagcaagattttctcaa |
15662125 |
T |
|
| Q |
204 |
gtcactgcctttgaagttgatatctggactagtggcattgtttgtgtctataatcagcatgatgatagcatttagtagtgctttctacataacatattat |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15662124 |
gtcactgcctttgaagttgatatctggactagtggcattgtttgtgtctataatcagcatgatgatagcatttagtagtgctttctacataacatattat |
15662025 |
T |
|
| Q |
304 |
catggtttgaaatgggttcctaattttatttctgttcttgcatttttaccgataccgttgtttatatgtttacagttttctctgtg |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15662024 |
catggtttgaaatgggttcctaattttatttctgttcttgcatttttaccgataccgttgtttatatgtttacagttttctctgtg |
15661939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University