View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9911_high_3 (Length: 299)
Name: NF9911_high_3
Description: NF9911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9911_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 18 - 285
Target Start/End: Complemental strand, 40761678 - 40761411
Alignment:
| Q |
18 |
agttgaaggagtagtaactcaacaaggttgcatctttgtatgatatctttcagaatatatggatgatttgccttaaacatatcccacattttgattgggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40761678 |
agttgaaggagtagtaactcaacaaggttgcatctttgtatgatatctttcagaatatatggttgatttgccttaaacatatcccacattttgattgggt |
40761579 |
T |
 |
| Q |
118 |
ggttggttctggtggaattatatcatttgggagggttatcctgcaattatgctatcacatatttcattcattaatttgttaatgaacaaacattagatga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40761578 |
ggttggttctggtggaattatatcatttgggagggttatcctgcaattatgctatcacatatttcattcattaatttgttaatgaacaaacattagatga |
40761479 |
T |
 |
| Q |
218 |
tgataaataagttatgttctttgggggcatgttatgtagtagatgtgttttagaagccaaagtctgtg |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40761478 |
tgataaataagttatgttctttgggggcatgttatgtagtagatgtgttttagaagccaaagtctgtg |
40761411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University