View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9912_high_20 (Length: 203)
Name: NF9912_high_20
Description: NF9912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9912_high_20 |
 |  |
|
| [»] scaffold0775 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0775 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: scaffold0775
Description:
Target: scaffold0775; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 463 - 665
Alignment:
| Q |
1 |
cctaacatcgcgcaaggcctgattcaattgctctgtgctcatcccctcttgaaccaaatactcaacagtttggctaacatcaccactcaccatttgaatg |
100 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
463 |
cctaacatcgcgcaaggcctgatacaactgctctgtgctcatcccctcctgaaccaaatactcaacagtttggctaacatcaccactcaccatttgaatg |
562 |
T |
 |
| Q |
101 |
gtatcaggtgagcctctctcctggtggtgttgctgctggtgtgcaatgatctgctccttaatcacttgcctcaaatgagatcccggaataggtggaaaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
563 |
gtatcaggtgagcctctctcctggtggtgctgctgctggtgtgcaatgatttgctcctcaatcgcttgcctcaaatgagatcccggaataggtggaaaaa |
662 |
T |
 |
| Q |
201 |
tct |
203 |
Q |
| |
|
||| |
|
|
| T |
663 |
tct |
665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University