View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9912_high_21 (Length: 201)
Name: NF9912_high_21
Description: NF9912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9912_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 184
Target Start/End: Complemental strand, 47885465 - 47885299
Alignment:
| Q |
18 |
ccatctgcaaccctatttgtgaatgattatcatgttgaagatggagacgacatgaattcatcaccagaaaaatacacacaacagattcttgatttgcaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47885465 |
ccatctgcaaccctatttgtgaatgattatcatgttgaagatggagacgacatgaattcatcaccagaaaaatacacacaacagattcttgatttgcaag |
47885366 |
T |
 |
| Q |
118 |
atcaaggtgcaccggttgggggaataggaattcaaggtcacattgatagtcctgtggggcctattgt |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47885365 |
atcaaggtgcaccggttgggggaataggaattcaaggtcacattgatagtcctgtggggcctattgt |
47885299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 97 - 184
Target Start/End: Original strand, 4623703 - 4623790
Alignment:
| Q |
97 |
aacagattcttgatttgcaagatcaaggtgcaccggttgggggaataggaattcaaggtcacattgatagtcctgtggggcctattgt |
184 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||| ||||| ||||| ||||||||||| ||||| |||||||| || |||||| |||| |
|
|
| T |
4623703 |
aacacattcttgatttgcaagaacaaggtgcacctgttggtggaattggaattcaaggacacatagatagtccagttgggcctgttgt |
4623790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University