View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9912_low_10 (Length: 384)
Name: NF9912_low_10
Description: NF9912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9912_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 19 - 377
Target Start/End: Complemental strand, 45713894 - 45713536
Alignment:
| Q |
19 |
ggatcttcaccgaaatctgttgactggagagattcctttggaccttgggaatctaatacaacttgtttattttgatgtttcaggcaatcaattatctgga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45713894 |
ggatcttcaccgaaatctgttgactggagagattcctttggaccttgggaatctaatacaacttgtttattttgatgtttcaggcaatcaattatctgga |
45713795 |
T |
|
| Q |
119 |
aagattccagagaagttatgcagcctagttaatctaaattaccttgatttctctcaaaacagattggaagggcctattccaataactggtatttgccaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45713794 |
aagattccagagaagttatgcagcctagttaatctaaattaccttgatttctctcaaaacagattggaagggcctattccaataactggtatttgccaaa |
45713695 |
T |
|
| Q |
219 |
acctatccgaagttagatttttgggaaacagaaacctttgtgggcagatgttgggtacaaattgtgaggtcaaaagcattggtagatattcattgtttaa |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45713694 |
acctatccgaagttagatttttgggaaacagaaacctttgtgggcagatgttgggtacaaattgtgaggtcaaaagcattggtagatattcattgtttaa |
45713595 |
T |
|
| Q |
319 |
tgtatggaggcttggtggaattgccatcgcagtcatattagtaaccttgatctctgctt |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45713594 |
tgtatggaggcttggtggaattgccatcgcagtcatattagtaaccttgatctttgctt |
45713536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University