View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9912_low_15 (Length: 257)
Name: NF9912_low_15
Description: NF9912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9912_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 35779284 - 35779071
Alignment:
| Q |
16 |
gtgttttctaaccctataattttcccaagagctttcaacttttcaaccctaaaatatctcnnnnnnngtaaccttagaattcccaatttttcccaccaaa |
115 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35779284 |
gtgttttctaaccctataatttttccaagagctttcaac--------cctaaaatatctctttttt-gtaaccttagaattcccaatttttcccaccaaa |
35779194 |
T |
|
| Q |
116 |
aactatgtcgataacatgaatttatagattaaacgcatgtgtgcccgttgcgcatgggtcgatacgctctgtgcataagccaacatccaagagtgaaaac |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
35779193 |
aactatgtcgataacatgaatttatatattaaacgcatgtgtgcccgttgtgcatgggtcgatacgctccgtgcataaggcaacatccaagagtgaaaac |
35779094 |
T |
|
| Q |
216 |
cagctttcaaggcatattcgacc |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
35779093 |
cagctttcaaggcatattcgacc |
35779071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University