View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9912_low_17 (Length: 252)
Name: NF9912_low_17
Description: NF9912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9912_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 250
Target Start/End: Original strand, 34675448 - 34675681
Alignment:
| Q |
17 |
atctctttccttcagagacaagttcagagacttcaaaaggaacttgattctgctaatgccgatcttcttcgctttgcttacaatgaaatctctccgaata |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675448 |
atctctttccttcagagacaagttcagagacttcaaaaggaacttgattctgctaatgccgatcttcttcgctttgcttacaatgaaatctctccgaatt |
34675547 |
T |
|
| Q |
117 |
cctctcttccacctcttcctcctcttgttgttccggcttcgtttcatcaatctcaaagacagtttagttcaagatttggtaatggaaatgttgatggaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675548 |
cctctcttccacctcttcctcctcttgttgttccggcttcgtttcatcaatctcaaagacagtttagttcaagatttggtaatggaaatgttgatggaaa |
34675647 |
T |
|
| Q |
217 |
tggattttactcttcttttccctatgctactcca |
250 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||| |
|
|
| T |
34675648 |
tggattttactcttcttttccttatgctattcca |
34675681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 89
Target Start/End: Original strand, 43583436 - 43583509
Alignment:
| Q |
16 |
catctctttccttcagagacaagttcagagacttcaaaaggaacttgattctgctaatgccgatcttcttcgct |
89 |
Q |
| |
|
||||||||| || || ||||||||||| || |||||||||||||| || ||||||| ||||||||||||||| |
|
|
| T |
43583436 |
catctcttttctacaaagacaagttcaaaggcttcaaaaggaactcgacgctgctaacaccgatcttcttcgct |
43583509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University