View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9912_low_18 (Length: 242)
Name: NF9912_low_18
Description: NF9912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9912_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 8571669 - 8571899
Alignment:
| Q |
1 |
gcattgggagtgaagctgccatctcagtacttgaagtctttgtgtggctaatttatttaattcatcaggacactatagcttggaattttgatgtgatcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8571669 |
gcattgggagtgaagctgccatctcagtacttgaagtctttgtgtggctaatttatttaattcatcaggacactatagcttggaattttgatgtgatcca |
8571768 |
T |
|
| Q |
101 |
tactatttttgatttagctactgctgcnnnnnnnnntgcaggttctgttgttcgaaacagttcgccaagacaagcttgtctggaaggaggataagagtgg |
200 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8571769 |
tactatttttgatttagttactgctgc---aaaaattgcaggttctgttgttcgaaacagttcgccaagacaagcttgtctggaaggaggataagagtgg |
8571865 |
T |
|
| Q |
201 |
tcattattccgttacaagtgcctatcgtctctgc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8571866 |
tcattattccgttacaagtgcctatcgtctctgc |
8571899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University