View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9912_low_20 (Length: 235)
Name: NF9912_low_20
Description: NF9912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9912_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 41 - 147
Target Start/End: Complemental strand, 4504014 - 4503903
Alignment:
| Q |
41 |
gtaggtgagtttaatatttgtggttattaacccttctcttctcaagnnnnnnn-----cacatgaaaatttgaaatttgtttggaggtacgattaaagtt |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4504014 |
gtaggtgagtttaatatttgtggttattaacccttctgttctcaagaaaaaaaaaaaacacatgaaaatttgaaatttgtttggaggtacgattaaagtt |
4503915 |
T |
 |
| Q |
136 |
tgaccaatacgt |
147 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4503914 |
tgaccaatacgt |
4503903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 151 - 218
Target Start/End: Complemental strand, 4503627 - 4503560
Alignment:
| Q |
151 |
tattccagtaatgatacaacctgggttctctcaaaagattgttctttaattgaagttcattaatatct |
218 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4503627 |
tattccagtaatgatacaacttgggttctctcaaaagattgttctttaattgaatttcattaatatct |
4503560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University