View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9912_low_21 (Length: 230)
Name: NF9912_low_21
Description: NF9912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9912_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 5 - 139
Target Start/End: Original strand, 8571308 - 8571441
Alignment:
| Q |
5 |
tcaaattttacctgcaatttatcataaaccacccctgtgtcataattagaaatgagtacttagctatgtgaaataaccctttttgattgtgtacaagacc |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8571308 |
tcaaattttacctgcaatttatcataaaccacccctgtgtcataattagaaatgagtacttagctatgtgaaataaccc-ttttgattgtgtacaagacc |
8571406 |
T |
 |
| Q |
105 |
aacatggaaagattatctcattattcaaagttcaa |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
8571407 |
aacatggaaagattatctcattattcaaagttcaa |
8571441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 144 - 230
Target Start/End: Original strand, 8571491 - 8571577
Alignment:
| Q |
144 |
attttgtgaaggcaactattgattcaattagtttgaaaatttcaactttatccttgtcctcatttacttactaagactgatattttt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8571491 |
attttgtgaaggcaactattgattcaattagtttgaaaatttcaactttatccttgtcctcatttacttactaagactgatattttt |
8571577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University