View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9912_low_3 (Length: 459)
Name: NF9912_low_3
Description: NF9912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9912_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 61; Significance: 5e-26; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 15 - 91
Target Start/End: Original strand, 29681248 - 29681324
Alignment:
| Q |
15 |
gagagtatactagtaattgctttgatttatagagcaaagcaagtcggtaggttgaaatattttgatttactgattta |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
29681248 |
gagagtatactagtaattgctttgatttatagaacaaaacaagtcggtcggttgaaatattttgatctactgattta |
29681324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 157 - 217
Target Start/End: Original strand, 29681322 - 29681382
Alignment:
| Q |
157 |
ttaatgtgacacttttatgcaattttgctttaagatgtttggtttggcgtttttctcttag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29681322 |
ttaatgtgacacttttatgcaattttgctttaagatgtttggtttggcgtttttctcttag |
29681382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 386 - 438
Target Start/End: Original strand, 29684216 - 29684268
Alignment:
| Q |
386 |
attttatacaccaaaacttcacaaaatcaaacctttcaattcaatttcggtgt |
438 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29684216 |
attttatacaccaaaacttcacaaaatcaaacctttcaattcaatttcggtgt |
29684268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 324 - 379
Target Start/End: Original strand, 29681947 - 29682002
Alignment:
| Q |
324 |
ctagcacacatgaaaatctcaaatagaaatcaaaacttcacaaaactaccttttct |
379 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29681947 |
ctagcgcacatgaaaatctcaaatagaaatcaaaacttcacaaaactaccttttct |
29682002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 244 - 295
Target Start/End: Original strand, 29681698 - 29681749
Alignment:
| Q |
244 |
tgacttgtctgaaaatatatccagctttaggaaaaatattccaatatccaat |
295 |
Q |
| |
|
|||||| | |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29681698 |
tgacttttgtgaaaataaatccagctttaggaaaaatattccaatatccaat |
29681749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University