View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_high_16 (Length: 400)
Name: NF9913A_high_16
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_high_16 |
 | |
|
| [»] scaffold0082 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0082 (Bit Score: 389; Significance: 0; HSPs: 1)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 389; E-Value: 0
Query Start/End: Original strand, 11 - 399
Target Start/End: Original strand, 51858 - 52246
Alignment:
| Q |
11 |
gtgttccagaatgggcagctaaagccttttatttgcctttcatgacgatgaatgaatagtcttctccctctgatcatgatcatggcttgcttaccgggac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51858 |
gtgttccagaatgggcagctaaagccttttatttgcctttcatgacgatgaatgaatagtcttctccctctgatcatgatcatggcttgcttaccgggac |
51957 |
T |
|
| Q |
111 |
ttcacttttcccttggttggatggaagtagcctcgtctcgtggcgccggtatcgaccatcgcacgagcagagtggccatttcattcagcactatctcaac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51958 |
ttcacttttcccttggttggatggaagtagcctcgtctcgtggcgccggtatcgaccatcgcacgagcagagtggccatttcattcagcactatctcaac |
52057 |
T |
|
| Q |
211 |
atacataagcccagcagacgtaggcttctaatgggtgatcgcattccgcaactgtaacggattcaccctaggggttcttccctcttgtcctcggcaacca |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52058 |
atacataagcccagcagacgtaggcttctaatgggtgatcgcattccgcaactgtaacggattcaccctaggggttcttccctcttgtcctcggcaacca |
52157 |
T |
|
| Q |
311 |
gcaagtttctccttcatcggacaatctcgtgcctgaggaggactcttacaaatgaaagagccagagtccgccttagaaggccttctttg |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52158 |
gcaagtttctccttcatcggacaatctcgtgcctgaggaggactcttacaaatgaaagagccagagtccgccttagaaggccttctttg |
52246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University