View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_101 (Length: 336)
Name: NF9913A_low_101
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_101 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 22 - 321
Target Start/End: Complemental strand, 33401803 - 33401504
Alignment:
| Q |
22 |
tcaactttagaaggtgtgtgtgctggagttcctatggcgacttggccactttcagctgagcaatttatcaatgagaagttgataactgatgtgttgagga |
121 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33401803 |
tcaactttagaaggtgtgtgtgctggagtacctatggcgacttggccactttcagctgagcaatttatcaatgagaagttgataactgatgtgttgagga |
33401704 |
T |
|
| Q |
122 |
ttggtgttcaagttggtagtagagagtgggggtcttgggatgaagagaggaaagagttggttggaagagagaaggtggagttggcagtgaagaagttgat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33401703 |
ttggtgttcaagttggtagtagagagtgggggtcttgggatgaagagaggaaagagttggttggaagagagaaggtggagttggcagtgaagaagttgat |
33401604 |
T |
|
| Q |
222 |
ggcgaagagtgaagagacagaggaaatgagaaggcgggttaaaagtatttctgagaatgcaaaaagagctgttgaagaaggtggaagttcttatgatgat |
321 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33401603 |
ggcggagagtgaagatacagaggaaatgagaaggcgggttaaaagtatttttgagaatgcaaaaagagctgttgaagaaggtggaagttcttatgatgat |
33401504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University