View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_105 (Length: 330)
Name: NF9913A_low_105
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_105 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 18 - 192
Target Start/End: Original strand, 10385537 - 10385711
Alignment:
| Q |
18 |
gacatcataattgtggtgttgtcttgctagatctagaaagaattttatcatcagagctatcttgcaaggggttgcagaactgttctttgacttgtagaat |
117 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10385537 |
gacatcataatcatggtgttgtcttgctagatctagaaagaattttatcatcagagctatcttgcaaggggttgcagaactgttctttgacttgtagaat |
10385636 |
T |
|
| Q |
118 |
gttgtgctttcttttgatgtttcaaaagggatagatgagtttaaggttctgtctatggtgagagatcggcgcata |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10385637 |
gttgtgctttcttttgatgtttcaaaagggatagatgagtttaaggttctgtctatggtgagagatcggcgcata |
10385711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University