View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_131 (Length: 301)
Name: NF9913A_low_131
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_131 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 297
Target Start/End: Complemental strand, 36268984 - 36268687
Alignment:
| Q |
1 |
gggaggtgggtcagtgcgttggcagactgtgaataatattagagagggtgttgggctaatagattgaggtcgactgcttgataatatttgtcggaaggtt |
100 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36268984 |
gggaggtgggtcagtgtgttggcatactgtgaataatattagagagggtgttgcgctagtagattgaggtcgactgcttgataatatttgtcggaaggtt |
36268885 |
T |
|
| Q |
101 |
ggggatgagtcttctactctgttttggaatgatccttggttggatggtagatctttgaaagatagttttagaagtttgtttgagttagctgataacaaat |
200 |
Q |
| |
|
|| ||||||||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36268884 |
ggtgatgagtcttctactttgttttgaaatgatccttggttggatcgtagatctttgaaagatagttttagaagtttgtttcagttagctgataacaaat |
36268785 |
T |
|
| Q |
201 |
tggcaacagtcgcggagatgttttctttgggttggggagtgaatgacgaggcct-gaagtagcgtatgaggttgcttgaaagtagcagtcaataatca |
297 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36268784 |
tggcaacggtcgcggaaatgttttctttgggttggggagtgaatgacgaggcttaaaagtagcgtatgaggttgcttgaaagtagcaatcaataatca |
36268687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University