View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_133 (Length: 299)
Name: NF9913A_low_133
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_133 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 11 - 299
Target Start/End: Complemental strand, 49007987 - 49007695
Alignment:
| Q |
11 |
tgatatgaaaacacccgcaacaacttttattctgtccaagttatccacttgagtagcaagtgttcggttcttgtcttcacacaccacgatcttgtttctt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49007987 |
tgatatgaaaacacccgcaacaacttttattctgtccaagttatccacttgagtagcaagtgttcggttcttgtcttcacacaccacgatcttgtttctt |
49007888 |
T |
 |
| Q |
111 |
gctctgatgagttctttcaaattatcacatgagctcaagaaaaccattgggaccttgcctgaagaaaaattccccggatagagagacaaaccagtgactt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49007887 |
gctctgatgagttctttcaaattatcacatgagctcaagaaaaccattgggaccttgcctgaagaaaaattccccggatagagagacaaaccagtgactt |
49007788 |
T |
 |
| Q |
211 |
tggctccatttccaagtgttaaatccccgtgaaattcacgatccattgtgccagcagcaactgttattaccta----agataaagttagttaa |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
49007787 |
tggctccatttccaagtgttaaatccccgtgaaattcacgatccattgtgccagcagcaactgttattacctattagagataaagttagttaa |
49007695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University