View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_163 (Length: 283)
Name: NF9913A_low_163
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_163 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 269
Target Start/End: Original strand, 36504927 - 36505195
Alignment:
| Q |
1 |
tcaacatggggagattagttataacttgtcgagatatgccgctatgtttaaaaacctacaatttttgactcttgactcatctgttagttttctcattgca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36504927 |
tcaacatggggagattagttataacttgtcgagatatgccgctatgtttaaaaacctgcaatttttgactcttgactcatctgttagttttctcattgca |
36505026 |
T |
|
| Q |
101 |
tctctccttgttcagggtgagcacatttattttctgctttgtttttgacatttttgaccagtaggaatcgagctcggtactctagggtttacaaccaacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36505027 |
tctctccttgttcagggtgagcacatttattttctgctttgtttttgacatttttgaccagtaggaatcgagctcggtactctagggtttacaaccaacc |
36505126 |
T |
|
| Q |
201 |
acttgtgctaagcccaggtggaggctaacatttgaattgcacatcagattctggccctgctcgtgatgt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36505127 |
acttgtgctaagcccaggtggaggctaacatgtgaattgcacatcagattctggccctgctcgtgatgt |
36505195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University