View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_175 (Length: 277)
Name: NF9913A_low_175
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_175 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 9946181 - 9945926
Alignment:
| Q |
1 |
tcatcttcaactgtaaccaccaccagtggttgtccattaggaccaggcacaatattttccgtgatctttttatgttcattgatatgaacgatatcggttt |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||| |||||||| |||||||||||||||| |||||||| || |||||||| |
|
|
| T |
9946181 |
tcatcttcaactgtaaccaccaccgttggttgtccaaaaggaccaggcacaatgttttccgtaatctttttatgttcatcgatatgaatgacatcggttt |
9946082 |
T |
|
| Q |
101 |
cttgtttcttcttcctcgtttgaacgcagcaaaataatgcaaaagcaagcatggagagcaaggcaatgccgccaaatgcaatgatgacaatgacaatgac |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9946081 |
cttgtttcttcttcctcttttgaacgcagcaaaataatgcaaaagcaagcatggagagcaaggcaatgccaccaaatgcaatgatgacaatgacaatgac |
9945982 |
T |
|
| Q |
201 |
tgtagggtggtatggagagggagaaggtggaagtggtggtggtggggatgggcgga |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9945981 |
tgtagggtggtatggagagggagaaggtggaagtggtggtggtggggatgggcgga |
9945926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 29 - 114
Target Start/End: Original strand, 1022129 - 1022214
Alignment:
| Q |
29 |
gttgtccattaggaccaggcacaatattttccgtgatctttttatgttcattgatatgaacgatatcggtttcttgtttcttcttc |
114 |
Q |
| |
|
|||||||| ||||||||| ||||| ||||| || ||||||||| |||| ||| || | |||||||||||||||| |||||||| |
|
|
| T |
1022129 |
gttgtccaaaaggaccaggtacaatggtttccttgccctttttatgctcatcgatgtgtatgatatcggtttcttgtgtcttcttc |
1022214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University