View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_181 (Length: 271)
Name: NF9913A_low_181
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_181 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 10789336 - 10789071
Alignment:
| Q |
1 |
tcaaccgaggattctctgccttgcgtgatattggtactggaaaagatgtgaagaaattcctcattgtacgtaacctgtgaacttgctagtcaataatata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10789336 |
tcaaccgaggattctctgccttgcgtgatattggtactggaaaagatgtgaagaaattcctcattgtacgtaacctgtgaacttgctagtcaataatata |
10789237 |
T |
|
| Q |
101 |
tgcttgcannnnnnnnn-atgatgtactgttagtataattttcataagtaatcttcataattgaatgaatgatgggggctaaatgcatgccaactataat |
199 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10789236 |
tgcttgcattttttgtttatgatctactgttagtataattttcataagtaatcttcataagtgaatgaatgatgggggctaaatgcatgccaactataat |
10789137 |
T |
|
| Q |
200 |
tacttaaataatttctaagatgtttgcctgcattttttgttcatgatctactgttagtattatttag |
266 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
10789136 |
tacttaaataatttcttagatgtttgcttgca-tttttgttcatgatctactgttagtataatttag |
10789071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University