View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_182 (Length: 270)
Name: NF9913A_low_182
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_182 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 26 - 258
Target Start/End: Complemental strand, 36272117 - 36271885
Alignment:
| Q |
26 |
tggaggaggatgtggcggaggagaatatcaaatgcctcatatgagaggaggagaacaagaaggctttgaaaatcaagggccctgggaatgtccataacaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36272117 |
tggaggaggatgtggcggaggagaatatcaaatgcctcatatgagaggaggagaacaagaaggctttgaaaatcaagggccctgggaatgtccataacaa |
36272018 |
T |
 |
| Q |
126 |
ttagagatatgaatgcaagtgttgcgtcccataaagtatgtataagaaaaatatgcaatttatcttactccatgtctagtctttattaggatgaactttt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36272017 |
atagagatatgaatgcaagtgttgcgtcccataaagtatgtataagaaaaatatgcaatttatcttactccatgtctagtctttattaggatgaactttt |
36271918 |
T |
 |
| Q |
226 |
ttcacttaaattaaaatatattttattgatatt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36271917 |
ttcacttaaattaaaatatattttattgatatt |
36271885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University