View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_193 (Length: 264)
Name: NF9913A_low_193
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_193 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 15 - 261
Target Start/End: Original strand, 29563196 - 29563442
Alignment:
| Q |
15 |
acatcacttctaaaattttaaaatttccacaggtttcttatatttcccaaaactggcctgttcaatatgtggcagctagtcaggatggaatgtacttagc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29563196 |
acatcacttctaaaattttaaaatttccacaggtttcttatatttcccaaaactggcctgttcaatatgtggcagctagtcaggatggaatgtacttggc |
29563295 |
T |
|
| Q |
115 |
ggttgctggtcttcatggtttgatattgtatgatatacgaatgaaaagatggagagtctttggagatgttacccaggaacaaaagattcagtgtaagggc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29563296 |
ggttgctggtcttcatggtttgatattgtatgatatacgaatgaaaagatggagagtctttggagatgttacccaggaacaaaagattcagtgtaagggc |
29563395 |
T |
|
| Q |
215 |
ttgctatggctgggaaagattgtcgttgtctgcaactatattgattc |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29563396 |
ttgctatggctgggaaagattgtcgttgtctgcaactatattgattc |
29563442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University