View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_221 (Length: 253)
Name: NF9913A_low_221
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_221 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 45 - 245
Target Start/End: Complemental strand, 32278853 - 32278653
Alignment:
| Q |
45 |
atgagtatacatactggaattttagaggcatatatgccgttttgcttccaaatttacgtacatcagacatgtccttattttgacatgagtatgaccaaag |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32278853 |
atgagtatacatactggaattttagaggcatatatgccgttttgcttccaaatttacgtacgtcagacatgtccttattttgacatgagtatgaccaaag |
32278754 |
T |
 |
| Q |
145 |
ctattctattcttgttgcctatactatcatagttattgacttgtttgtttatacaaatagaatgcagagttctcttgcataattgtgagtgaatattttt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32278753 |
ctattctattcttgttgcctatactatcatagttattgacttgtttgtttatacaaatagaatgcagagttctcttgcataattgtgagtgaattttttt |
32278654 |
T |
 |
| Q |
245 |
c |
245 |
Q |
| |
|
| |
|
|
| T |
32278653 |
c |
32278653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University