View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_229 (Length: 251)
Name: NF9913A_low_229
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_229 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 14 - 251
Target Start/End: Original strand, 28182642 - 28182879
Alignment:
| Q |
14 |
gatggacatcaatcgttgtagagaggttggcatcattcatcatttggaggtcttggctgcaactgttttggtgctacatgcaattgaggagtcaggaagt |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28182642 |
gatgcacatcaatcgttgtagagaggttggcatcattcatcatttggaggtcttggctgcaactgttttggtgctacatgcaattgaggagtcaggaagt |
28182741 |
T |
 |
| Q |
114 |
aactcacaaatatatatatcatgactttccagagattctaatccatcttttgatcttacaagttactgttccatggttgattattttcatttgaaacaaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28182742 |
aactcacaaatatatatatcatgactttccagagattctaatccatcttttgatcttacaagttactgttccatggttgattattttcatttgaaacaaa |
28182841 |
T |
 |
| Q |
214 |
acttggaactcctgttgtataaataaatcaatcttata |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28182842 |
acttggaactcctgttgtataaataaatcaatcttata |
28182879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University