View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_234 (Length: 251)
Name: NF9913A_low_234
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_234 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 12 - 223
Target Start/End: Original strand, 37425898 - 37426109
Alignment:
| Q |
12 |
atgaagcagctcctagaaacatatcgaaagagaccaagtgttagtttgcaggtagcctggggagggaagagattcccaaagcacggttagaatgctggat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37425898 |
atgaagcagctcctagaaacatatcgaaagagaccaagtgttagtttgcaggtagcctgggaagggaagagatttccaaagcacggttagaatgctggat |
37425997 |
T |
|
| Q |
112 |
ttcagcacacttcgtcagccggaacaccattctctgattctgaatctcatatcaagctttttcaatatctactattcacatcagaatgattagcaacaaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37425998 |
ttcagcacacttcgtcagccggaacaccattctctgattctgaatctcatatcaagctttttcaatatctactattcacatcagaatgattagcaacaaa |
37426097 |
T |
|
| Q |
212 |
catgctgaccct |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37426098 |
catgctgaccct |
37426109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University