View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_237 (Length: 250)
Name: NF9913A_low_237
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_237 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 5 - 239
Target Start/End: Original strand, 39485446 - 39485686
Alignment:
| Q |
5 |
agaagaaacaaactaacatcgcaagaaagtgagcaccataannnnnnnnnaaggattgagcgatccaaacatgttaatttgatgaaggtctttgatgtct |
104 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39485446 |
agaagaaacaa-ctaacatcgcaagaaagtgagcaccataatttttttt-aaggattgagcgatccaaacatgtcaatttgatgaaggtctttgatgtct |
39485543 |
T |
|
| Q |
105 |
tatatcaaagtaatatacttatgaaacatgtgagtttggtcataaaggatgtcaaagtaatgaagagaatatttaaaacaaattatg--------ttacg |
196 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
39485544 |
tatatcaaagtaatatgcttatgaaacatgtgagtttggtcataaaggatgtcaaagtaatgaagagaatatttaagacaaattatgttacggacttacg |
39485643 |
T |
|
| Q |
197 |
gtaattcaagtgcatagtcagaataagaccttgatgggtaaca |
239 |
Q |
| |
|
||||||||| | |||||||||||||||||||||| | |||||| |
|
|
| T |
39485644 |
gtaattcaactacatagtcagaataagaccttgacgagtaaca |
39485686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University