View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_239 (Length: 250)
Name: NF9913A_low_239
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_239 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 45751300 - 45751532
Alignment:
| Q |
1 |
gaattttacatgctgacatcccatgttcggttggcctgggtcttctcggagttcctttttagtgtaagatataattgcaaaacgnnnnnnngtccctttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45751300 |
gaattttacatgctgacatcccatgttaggttggcctgggtcttctcggagttcctttttagtgtaagatataattgcaaaacgtttttttgtccctttg |
45751399 |
T |
 |
| Q |
101 |
ctcgttaactcaataatagttgactgacagctgaaataattgtacagcctatgtaaatagaaaattaatctattgcttccatgttcttgatcctccttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45751400 |
ctcgttaactcaataatagttgactgacagctgaaataattgtacagcctatgtaaatagaaaattaatctattgcttccatgttcttgatcctccttta |
45751499 |
T |
 |
| Q |
201 |
tgtggttttgacagagtatgattcacttgatgt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45751500 |
tgtggttttgacagagtatgattcacttgatgt |
45751532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University