View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_269 (Length: 246)
Name: NF9913A_low_269
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_269 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 14576844 - 14576612
Alignment:
| Q |
1 |
gctcatcgttttcggacaacttaaacttacgaaaatttctcttactaatttcatcttcagaagagattggggtttctagcttttcatagtctcnnnnnnn |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
14576844 |
gctcatcattttcggacaacttaaacttacgaaaatttctcttactaatttcatctttagaagagattggggtttctagattttcctagtctcttttttt |
14576745 |
T |
 |
| Q |
101 |
atcttcaaaatacgacacaattgttgcaacaaggttccttgatgattcaacaccttccaaatcaatctaaccttcttaaattggtatagcaagagttgaa |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14576744 |
atcttcaaaataagacacaattgttgcaacaaggttccttgatgattcaacaccttccaaatcaatctaaccttcttaaattggtagagcaagagttgaa |
14576645 |
T |
 |
| Q |
201 |
ttcaaagtctggtctggcaagagagatgtccat |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
14576644 |
ttcaaagtctggtctggcaagagagatgtccat |
14576612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University