View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_27 (Length: 438)
Name: NF9913A_low_27
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 21 - 406
Target Start/End: Original strand, 41630047 - 41630429
Alignment:
| Q |
21 |
ctgaagaagatgttgctatgtgtctcatgatgctttcgagggacaaatggagtcgaaagatgaacaacgacaacaatgtggaacaagaagaagatgaggg |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41630047 |
ctgaagaagatgttgctatgtgtctcatgatgctttcgagggacaaatggagtcgaaagatgaacaacgtcaacaatgtggaacaagaagaagatgaggg |
41630146 |
T |
|
| Q |
121 |
atcggtggagaaaatatcgaaggtgaagttattgaaacgagttcgtgggaagcatttatgcgaaaattgtgggaaaacatttcgatcttctagagcattg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41630147 |
atcggtggagaaaatatcgaaggtgaagttattgaaacgagttcgtgggaagcatttatgcgaaaattgtgggaaaacatttcgatcttctagagcattg |
41630246 |
T |
|
| Q |
221 |
ggaagtcatagaagtatttgttgtcgcgatgaagcgaagaagaatggtaatggtaacgatgataagatttttgaatgtccattttgttttaaggtttttg |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41630247 |
ggaagtcatagaagtatttgttgtcgcgatgaagc---gaagaatggtaatggtaacgatgataagatttttgaatgtccattttgttttaaggtttttg |
41630343 |
T |
|
| Q |
321 |
gttctggtcaagcacttggtggtcacaagagatctcatctcatgatcccttcttcatcaacttccactgctaatgttaacgttaat |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41630344 |
gttctggtcaagcacttggtggtcacaagagatctcatctcatgatcccttcttcatcaacttccactgctaatgttaatgttaat |
41630429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University