View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_272 (Length: 246)
Name: NF9913A_low_272
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_272 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 21445324 - 21445096
Alignment:
| Q |
18 |
catatagttgatatcttaatgtgttgagtggagatgtggtgttctcatctcatgttggtcctagattattgacttgttgttgctttcgatagtcacgtag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
21445324 |
catatagttgatatcttaatgtgttgagtggagatgcggtgttctcatctcatgttggtcctagattattgacttgttcttgcttccgatagtcacgtag |
21445225 |
T |
|
| Q |
118 |
acttacactttatgaaagattgttgagtcaagtgattagtcataaatctattatgaatgaactaaatgttgaatataaatagatgtaactcatacactta |
217 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21445224 |
acttacattttatgagagattgttgagtcaagtgattagtcataaatctattatgaatgaactaaatgttgaatataaatagatgtaactcatacactta |
21445125 |
T |
|
| Q |
218 |
accacttaaaattttatgtgaagatgtga |
246 |
Q |
| |
|
| ||||||||||||||||||||||||||| |
|
|
| T |
21445124 |
atcacttaaaattttatgtgaagatgtga |
21445096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University