View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_273 (Length: 245)
Name: NF9913A_low_273
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_273 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 14 - 245
Target Start/End: Original strand, 45750943 - 45751174
Alignment:
| Q |
14 |
catcaaaataaaattgaagaatcaaactggtgccgcaagcagacagctcgttgcctcaccggaacctaggttaggaagaaacatgatagataatggctca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45750943 |
catcaaaataaaattgaagaatcaaactggtgccgcaagcagacagctcgttgcctcaccggaacctaggttaggaagaaacatgatagataatggctca |
45751042 |
T |
 |
| Q |
114 |
gatagcgagcttccatcatctgaaagttgctattccgatgatcaggatgaatgtgcgttgattgatgcacttgccactgcaatttcacatgtgaggatat |
213 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45751043 |
gttagcgagcttccatcatctgaaagttgctattccgacgatcaggatgaatgtgcgttgattgatgcacttgccactgcaatttcacatgtgaggatat |
45751142 |
T |
 |
| Q |
214 |
ctgaaccaaagaggaccagattgtgtagtcct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45751143 |
ctgaaccaaagaggaccagattgtgtagtcct |
45751174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University