View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_275 (Length: 245)
Name: NF9913A_low_275
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_275 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 8 - 245
Target Start/End: Complemental strand, 10567053 - 10566816
Alignment:
| Q |
8 |
caatgagatggacatcaactcggaggttccatgtatggggactgattatttagagttcatgaagacgattagatctattccagaccgtggtgagtttgaa |
107 |
Q |
| |
|
|||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10567053 |
caatgagaaggaaaacaactcggaggttccatgtatggggactgattatttagagttcatgaagacgattagatctattccagaccgtggtgagtttgaa |
10566954 |
T |
 |
| Q |
108 |
agtcaatatagtgctatctctgagttatatagttgttctggaccctcagtaacatcctcttggcaaaaggaccaaagtaaatttgtagtgatgtccactg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10566953 |
agtcaatatagtgctatctctgagttatatagttgttctggaccctcagtaacatcctcttggcaaaaggaccaaagtaaatttgtagtgatgtccactg |
10566854 |
T |
 |
| Q |
208 |
atgctatggataaggattcaaataatagacattctgta |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10566853 |
atgctatggataaggattcaaataatagacattctgta |
10566816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University