View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_283 (Length: 245)
Name: NF9913A_low_283
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_283 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 67 - 237
Target Start/End: Original strand, 41744236 - 41744406
Alignment:
| Q |
67 |
tacacaatagacaccatcatttctcattgtttaccctaaaatagacatcgtcttttctcatcatatgtatttatatatatgtttatgacattactcctta |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |||| | |
|
|
| T |
41744236 |
tacacaatagacaccatcatttctcattgtttaccctaaaatagacgtcgtcttttctcatcatatgtatttatatatatgtttatgaaattagtcctca |
41744335 |
T |
|
| Q |
167 |
ttactcttgtttacgatcataaaattcttcatcattacccccatcaatacgtttatatcactaccctattc |
237 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41744336 |
ttactcttgtttatggtcataaaattcttcatcattacccccatcaatacgtttatatcactaccctattc |
41744406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 150 - 235
Target Start/End: Complemental strand, 18785090 - 18785005
Alignment:
| Q |
150 |
tatgacattactccttattactcttgtttacgatcataaaattcttcatcattacccccatcaatacgtttatatcactaccctat |
235 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||| |||||||| || ||| |||||||||| ||||||| || |||||||||| |
|
|
| T |
18785090 |
tatgacattacttcttattactcttgtttatagtcaataaattctttattatttcccccatcaagacgtttagattactaccctat |
18785005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 175
Target Start/End: Complemental strand, 34635625 - 34635574
Alignment:
| Q |
124 |
tcatcatatgtatttatatatatgtttatgacattactccttattactcttg |
175 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||| ||| || ||||||| |
|
|
| T |
34635625 |
tcatcatatgtatttatatataagtatatgacattacccctcatcactcttg |
34635574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University