View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_300 (Length: 243)
Name: NF9913A_low_300
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_300 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 9 - 243
Target Start/End: Original strand, 3469452 - 3469686
Alignment:
| Q |
9 |
tggtgtttgttgattataccaggtatctgcccgatacaatcgatgtcggcaatggtggacgacaacagagatccacaggctgtgaatgttgagtagagtt |
108 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3469452 |
tggtgtttgttgactataccaggtatctgcccgatacaatcgatgtcggcaatggtggacgacaacagagatccacaggctgtgaatgttgagtagagtt |
3469551 |
T |
|
| Q |
109 |
ctatggaccaggtttacctgtttgtttgatgccaaacaatcctcttagtgtttttgagccaccaactattttattaccaatgtaaaaccaaggacaaatt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3469552 |
ctatggaccaggtttacctgtttgtttgatgccaaacaatcctcttagtgtttttgagccaccaactattttattaccaatgtaaaatcaaggacaaatt |
3469651 |
T |
|
| Q |
209 |
gcatattccattttgtatctcagtagtggcttaga |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3469652 |
gcatattccattttgtatctcagtagtggcttaga |
3469686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 110
Target Start/End: Complemental strand, 39873188 - 39873140
Alignment:
| Q |
62 |
ggtggacgacaacagagatccacaggctgtgaatgttgagtagagttct |
110 |
Q |
| |
|
|||||||| |||||||| || |||||||||||||||||| |||||||| |
|
|
| T |
39873188 |
ggtggacggcaacagaggtcaacaggctgtgaatgttgataagagttct |
39873140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University