View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_306 (Length: 242)
Name: NF9913A_low_306
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_306 |
 | |
|
| [»] scaffold0015 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0015 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 25 - 226
Target Start/End: Complemental strand, 177883 - 177682
Alignment:
| Q |
25 |
caaaatccgccgggaatacaaatgtatcaactttaacaagcacatcttcggctattcccaatggtgttgcaaatgatttgtcggccaactgcaaggtcat |
124 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
177883 |
caaaatccgccgggaatacaaatttatcaactttaacaagcacatcttcggctattcccaatggtgttgcaaatgatttatcggccaattgcaaggtcat |
177784 |
T |
|
| Q |
125 |
cctagtccgcttgatacataaatcaccaactcttttggcgacggacaagggcatgagatttatgcttgaaccaaggtcaagtagtgccttaccaacattg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
177783 |
cctagtccgcttgatacataaatcaccaactcttttggcgacggacaaaggcatgagatttatgcttgaaccaaggtcaagtagtgccttaccaacattg |
177684 |
T |
|
| Q |
225 |
at |
226 |
Q |
| |
|
|| |
|
|
| T |
177683 |
at |
177682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 44 - 210
Target Start/End: Complemental strand, 20171485 - 20171319
Alignment:
| Q |
44 |
aaatgtatcaactttaacaagcacatcttcggctattcccaatggtgttgcaaatgatttgtcggccaactgcaaggtcatcctagtccgcttgatacat |
143 |
Q |
| |
|
|||| |||||||||| || |||||||| || ||||||||||||||| ||| | ||||| |||||||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
20171485 |
aaatttatcaactttcactagcacatcctccgctattcccaatggttttgtgtaggatttatcggccaattgcaaagtcatcctagtccgcttaatacac |
20171386 |
T |
|
| Q |
144 |
aaatcaccaactcttttggcgacggacaagggcatgagatttatgcttgaaccaaggtcaagtagtg |
210 |
Q |
| |
|
|| ||||||||||||||||| || ||||| |||||||| || |||||||| ||||| |||||||||| |
|
|
| T |
20171385 |
aagtcaccaactcttttggcaacagacaaaggcatgaggttgatgcttgagccaagatcaagtagtg |
20171319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University