View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_315 (Length: 240)
Name: NF9913A_low_315
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_315 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 9378155 - 9378375
Alignment:
| Q |
1 |
gaaacattataataaatttatttattcaatttggagtttagtgttattcaagtaattgcaaccatcctcatccgtattgtttt-ttagttaatcctctgg |
99 |
Q |
| |
|
|||||| |||||||| ||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9378155 |
gaaacaatataataagtttgtttatacaatttggagtttagtgttattcaagtaattgcaaccatcctcatccgtattgtttttttagttaatcctctgg |
9378254 |
T |
|
| Q |
100 |
tttttagggaaaatgggctctgataatccggagttcggttatgaggtaaagatgatatgacctagaattgttccacacaataatcgaactcggattct-c |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| ||||||||||||| | |
|
|
| T |
9378255 |
tttttagggaaaatgggctctgataatccggagttcggttatgaggtaaatatgatatgacctagaattgttccacacagtaatggaactcggattctcc |
9378354 |
T |
|
| Q |
199 |
cgaaccatccgtccttggtga |
219 |
Q |
| |
|
||||| ||||||||||||||| |
|
|
| T |
9378355 |
cgaacgatccgtccttggtga |
9378375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 88 - 136
Target Start/End: Complemental strand, 35581174 - 35581126
Alignment:
| Q |
88 |
ttaatcctctggtttttagggaaaatgggctctgataatccggagttcg |
136 |
Q |
| |
|
|||||||| ||||||||||||||||| | ||||||||| ||||||||| |
|
|
| T |
35581174 |
ttaatcctttggtttttagggaaaatagattctgataattcggagttcg |
35581126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University