View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_330 (Length: 236)
Name: NF9913A_low_330
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_330 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 12 - 236
Target Start/End: Complemental strand, 54454729 - 54454505
Alignment:
| Q |
12 |
tggacatcaggatcgtcagcatccacacaccatgatgtttataccgctcaggggtatgtatgcaccatacgagtacatagaccatctggatcagttggat |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54454729 |
tggatatcaggatcgtcagcatccacacaccatgatgtttataccgctcaggggtatgtttgcaccatacgagtacatagaccatctggatcagttggat |
54454630 |
T |
|
| Q |
112 |
ctgggtggtgtattcatgacctcatatgctgaccaccgtgatctatgtatgttcgagtctgtcagcctttactaaaggatggttgagataagatatctgc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54454629 |
ctgggtggtgtattcatgacctcatatgctgaccaccgtgatctatgtctgttcgagtctgtcagcctttactaaaggatggttgagataagatatctgc |
54454530 |
T |
|
| Q |
212 |
aaggtaagatatttgccggagtggg |
236 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
54454529 |
aaggtaagatatttgccggagtggg |
54454505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 31 - 105
Target Start/End: Original strand, 14912139 - 14912213
Alignment:
| Q |
31 |
catccacacaccatgatgtttataccgctcaggggtatgtatgcaccatacgagtacatagaccatctggatcag |
105 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| |||||| | ||||| ||||||||| | |||||||||||||| |
|
|
| T |
14912139 |
catccacacgccatgatgtttgtaccgctcaggagtatgtctccaccagacgagtacaaaaaccatctggatcag |
14912213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 35 - 148
Target Start/End: Complemental strand, 32463628 - 32463515
Alignment:
| Q |
35 |
cacacaccatgatgtttataccgctcaggggtatgtatgcaccatacgagtacatagaccatctggatcagttggatctgggtggtgtattcatgacctc |
134 |
Q |
| |
|
||||| ||||||||||| ||||||||| ||||||| ||||||| ||||||| | |||||||||||||||| ||||| ||| || | |||||| || | |
|
|
| T |
32463628 |
cacacgccatgatgtttgtaccgctcaaaggtatgtttgcaccagacgagtatagagaccatctggatcagctggatatggcgagtattttcatggcccc |
32463529 |
T |
|
| Q |
135 |
atatgctgaccacc |
148 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
32463528 |
atatgctgagcacc |
32463515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University