View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_332 (Length: 236)
Name: NF9913A_low_332
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_332 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 21 - 218
Target Start/End: Original strand, 38483684 - 38483881
Alignment:
| Q |
21 |
tatttttggagtaagaggtgttttgagaaattgaaatggcctattgatatcgggagtagttttttcgatggaaatcgtgttgggaagacaggttttgttg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38483684 |
tatttttggagtaagaggtgttttgagaaattgaaatggcctattgatattgggagtagttttttcgatggaaatcgtgttgggaagacgggttttgttg |
38483783 |
T |
|
| Q |
121 |
aacggaggtcgttttggaatttgtttaggagttttgatgggctttgggtgatgttgattttgtttcttcaagtggcgattattgttggttggaatgat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38483784 |
aacggaggtcgttttggaatttgtttaggagttttgataggctttgggtgatgttgattttgtttcttcaagtggcgattattgttggttggaatgat |
38483881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 98 - 192
Target Start/End: Original strand, 30118163 - 30118257
Alignment:
| Q |
98 |
tgttgggaagacaggttttgttgaacggaggtcgttttggaatttgtttaggagttttgatgggctttgggtgatgttgattttgtttcttcaag |
192 |
Q |
| |
|
|||||| ||||| || |||||||| | ||| |||||||||||| ||||| |||||||||| |||||||| | |||||| | ||||||||||||| |
|
|
| T |
30118163 |
tgttggtaagaccggatttgttgagcagagatcgttttggaatctgtttcggagttttgacaggctttggattatgttggtgttgtttcttcaag |
30118257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 21 - 85
Target Start/End: Original strand, 30118074 - 30118138
Alignment:
| Q |
21 |
tatttttggagtaagaggtgttttgagaaattgaaatggcctattgatatcgggagtagtttttt |
85 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||| |||| | ||||||| |||||| |
|
|
| T |
30118074 |
tatttttggagtaggaggtgttttgagaagatgaaatggcctcctgatgttgggagtaatttttt |
30118138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University