View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_339 (Length: 234)
Name: NF9913A_low_339
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_339 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 99 - 219
Target Start/End: Original strand, 9561838 - 9561958
Alignment:
| Q |
99 |
ataaatcatctttcagaactattcgtcggtgatgtctctccaccctgaaattattgacggaaggccaggaacactagtaattgaatcttttgtggtggat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9561838 |
ataaatcatctttcagaactattcgtcggtgatgtctctccaccctgaaattattgacggaaggccaggaacactagtaattgaatcttttgtggtggat |
9561937 |
T |
|
| Q |
199 |
atacctgacgggaacaccaaa |
219 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9561938 |
atacctgacgggaacaccaaa |
9561958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 109 - 218
Target Start/End: Complemental strand, 41328089 - 41327980
Alignment:
| Q |
109 |
tttcagaactattcgtcggtgatgtctctccaccctgaaattattgacggaaggccaggaacactagtaattgaatcttttgtggtggatatacctgacg |
208 |
Q |
| |
|
||||||||||| || || | ||||| ||||| || ||||||||||| ||||| |||||||| || |||||||||||||||||||| ||| |||| || | |
|
|
| T |
41328089 |
tttcagaactactcatctatcatgtccctccatccagaaattattgatggaagaccaggaaccctggtaattgaatcttttgtggtagatgtaccagagg |
41327990 |
T |
|
| Q |
209 |
ggaacaccaa |
218 |
Q |
| |
|
|||| ||||| |
|
|
| T |
41327989 |
ggaataccaa |
41327980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University