View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_357 (Length: 231)
Name: NF9913A_low_357
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_357 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 20 - 192
Target Start/End: Original strand, 48973875 - 48974047
Alignment:
| Q |
20 |
atcaataagattagggaaatataagtaacttgttatgactcaataagataaaaacaggaataatttcatgaaaaacttgcactcataaacatttttccat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48973875 |
atcaataagattagggaaatataagtaacttgttatgactcaataagataaaa-caggaataatttcatgaaaaacttgcactcataaacatttgtccat |
48973973 |
T |
 |
| Q |
120 |
gcatcctt-nnnnnnnnnnntatattgtccatgcaaattatgtaacaataaaggctaaccatgtgtatgatgtc |
192 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48973974 |
gcatccttaaaaaaaaaatatatattgtccatgcaaattatgtaacaataaaggctaaccgtgtgtatgatgtc |
48974047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University