View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_372 (Length: 230)
Name: NF9913A_low_372
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_372 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 9 - 230
Target Start/End: Complemental strand, 16343225 - 16343005
Alignment:
| Q |
9 |
actgtccaaaagtcgtaaaaacaacttaaattttgaaaccattcttcaatactttgactatgttttttatgtcaatcacgaaggcaacaccttattcttt |
108 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||| ||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
16343225 |
actgtccagaagtcgtaaaaacaatttaaattttgataccgttcttcaatactttgactatgttttttgtgtcaatcacgaaggcaacaccttattcttt |
16343126 |
T |
|
| Q |
109 |
taannnnnnnnccttcaacgcaaaacaaccttcacccaaaacttgacaatcattttatatgtcttttaccaattcttgattacccagcaaaatcg-cccc |
207 |
Q |
| |
|
||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
16343125 |
taattttttt-ccttcaacgcaaaacaaccttcactcaaaacttgacaatcattttatatgtcttttaccaattcttga-tacccagcaaaatcgccccc |
16343028 |
T |
|
| Q |
208 |
aacactcaaccgtcctaaaatga |
230 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
16343027 |
aacactcaaccgtcctaaaatga |
16343005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University