View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_377 (Length: 230)
Name: NF9913A_low_377
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_377 |
 |  |
|
| [»] scaffold0031 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 96 - 229
Target Start/End: Complemental strand, 13915858 - 13915725
Alignment:
| Q |
96 |
gatagcacatacatttgccttttgaatgcttttcatgttgcatgcatatgtctttcaacttcaatctcagagattccataaattggatgctccctcactc |
195 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13915858 |
gatagcacatacatttgccctttgaatgcttttcatgttgcatgcatatgtctttcaacttcaatctcagagattccataaattggatgctccctcactc |
13915759 |
T |
 |
| Q |
196 |
aaccaattttttaacaaacactaccccacatgtg |
229 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
13915758 |
aaccaattttttaacagacactaccccacatgtg |
13915725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 101 - 229
Target Start/End: Original strand, 17316680 - 17316809
Alignment:
| Q |
101 |
cacatacatttgccttttgaatgcttttcatgttg-catgcatatgtctttcaacttcaatctcagagattccataaattggatgctccctcactcaacc |
199 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
17316680 |
cacattcatttgctttttgaatgcttttcatgttggcatgcatatgtctttcaacttcaatctcagagattccctaaattggatggtccctcactcaacc |
17316779 |
T |
 |
| Q |
200 |
aattttttaacaaacactaccccacatgtg |
229 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |
|
|
| T |
17316780 |
aattttttaacaaacagtaccccacatgtg |
17316809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 96 - 171
Target Start/End: Original strand, 17320944 - 17321020
Alignment:
| Q |
96 |
gatagcacatacatttgccttttgaatgcttttcatgttg-catgcatatgtctttcaacttcaatctcagagattc |
171 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17320944 |
gatagcacattcatttgctttttcaatgcttttcatgttggcatgcatatgtctttcaacttcaatctcagagattc |
17321020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 101 - 171
Target Start/End: Original strand, 17321020 - 17321091
Alignment:
| Q |
101 |
cacatacatttgccttttgaatgcttttcatgttg-catgcatatgtctttcaacttcaatctcagagattc |
171 |
Q |
| |
|
||||| ||||||| |||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17321020 |
cacattcatttgctttttgaatgcttttgatgttggcatgcatatgtctttcaacttcaatctcagagattc |
17321091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 101 - 153
Target Start/End: Original strand, 17321091 - 17321144
Alignment:
| Q |
101 |
cacatacatttgccttttgaatgcttttcatgtt-gcatgcatatgtctttcaa |
153 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17321091 |
cacattcatttgctttttgaatgcttttcatgttggcatgcatatgtctttcaa |
17321144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 135 - 171
Target Start/End: Original strand, 17316644 - 17316680
Alignment:
| Q |
135 |
gcatgcatatgtctttcaacttcaatctcagagattc |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17316644 |
gcatgcatatgtctttcaacttcaatctcagagattc |
17316680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 96 - 229
Target Start/End: Complemental strand, 29066734 - 29066601
Alignment:
| Q |
96 |
gatagcacatacatttgccttttgaatgcttttcatgttgcatgcatatgtctttcaacttcaatctcagagattccataaattggatgctccctcactc |
195 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
29066734 |
gataggacatacatttgccttttgaatgctttttatgttgcatgcatatgtctttcaacttcaatcttagagattccataaattggatactccctcactc |
29066635 |
T |
 |
| Q |
196 |
aaccaattttttaacaaacactaccccacatgtg |
229 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |
|
|
| T |
29066634 |
aatcaattttttaacaaacactaccccacatgtg |
29066601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 102; Significance: 8e-51; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 101 - 229
Target Start/End: Original strand, 24021988 - 24022117
Alignment:
| Q |
101 |
cacatacatttgccttttgaatgcttttcatgttg-catgcatatgtctttcaacttcaatctcagagattccataaattggatgctccctcactcaacc |
199 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
24021988 |
cacattcatttgctttttgaatgcttttcatgttggcatgcatatgtctttcaacttcaatctcagagattccctaaattggatggtccctcactcaacc |
24022087 |
T |
 |
| Q |
200 |
aattttttaacaaacactaccccacatgtg |
229 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |
|
|
| T |
24022088 |
aattttttaacaaacagtaccccacatgtg |
24022117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 96 - 171
Target Start/End: Original strand, 24021841 - 24021917
Alignment:
| Q |
96 |
gatagcacatacatttgccttttgaatgcttttcatgttg-catgcatatgtctttcaacttcaatctcagagattc |
171 |
Q |
| |
|
|||||||||| ||||||| |||||||| |||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24021841 |
gatagcacattcatttgctttttgaatacttttcatgttggcatgcatgtgtctttcaacttcaatctcagagattc |
24021917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 101 - 171
Target Start/End: Original strand, 24021917 - 24021988
Alignment:
| Q |
101 |
cacatacatttgccttttgaatgcttttcatgttg-catgcatatgtctttcaacttcaatctcagagattc |
171 |
Q |
| |
|
||||| ||||||| |||||||||||||| |||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24021917 |
cacattcatttgctttttgaatgcttttgatgttggcatgcatatgtctttcaagttcaatctcagagattc |
24021988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 101 - 229
Target Start/End: Complemental strand, 22282971 - 22282842
Alignment:
| Q |
101 |
cacatacatttgccttttgaatgcttttcatgttg-catgcatatgtctttcaacttcaatctcagagattccataaattggatgctccctcactcaacc |
199 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
22282971 |
cacattcatttgctttttgaatgcttttcatgttggcatgcatatgtctttcaacttcaatctcagagattccctaaattggatggtccctcactcaacc |
22282872 |
T |
 |
| Q |
200 |
aattttttaacaaacactaccccacatgtg |
229 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |
|
|
| T |
22282871 |
aattttttaacaaacagtaccccacatgtg |
22282842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 121 - 171
Target Start/End: Complemental strand, 22283022 - 22282971
Alignment:
| Q |
121 |
atgcttttcatgttg-catgcatatgtctttcaacttcaatctcagagattc |
171 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22283022 |
atgcttttcatgttggcatgcatatgtctttcaacttcaatctcagagattc |
22282971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 107 - 229
Target Start/End: Complemental strand, 16536851 - 16536728
Alignment:
| Q |
107 |
catttgccttttgaatgcttttcatgtt-gcatgcatatgtctttcaacttcaatctcagagattccataaattggatgctccctcactcaaccaatttt |
205 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
16536851 |
catttgctttttgaatgcttttcatgttagcatgcatatgtctttcaacttcaatctcagagattccataaattggatggtccttcactcaaccaatttt |
16536752 |
T |
 |
| Q |
206 |
ttaacaaacactaccccacatgtg |
229 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
16536751 |
ttaacaaacactacaccacatgtg |
16536728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 57; Significance: 6e-24; HSPs: 3)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 96 - 171
Target Start/End: Complemental strand, 84792 - 84716
Alignment:
| Q |
96 |
gatagcacatacatttgccttttgaatgcttttcatgttg-catgcatatgtctttcaacttcaatctcagagattc |
171 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
84792 |
gatagcacattcatttgctttttcaatgcttttcatgttggcatgcatatgtctttcaacttcaatctcagagattc |
84716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 101 - 171
Target Start/End: Complemental strand, 84716 - 84645
Alignment:
| Q |
101 |
cacatacatttgccttttgaatgcttttcatgttg-catgcatatgtctttcaacttcaatctcagagattc |
171 |
Q |
| |
|
||||| ||||||| |||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
84716 |
cacattcatttgctttttgaatgcttttgatgttggcatgcatatgtctttcaacttcaatctcagagattc |
84645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 101 - 153
Target Start/End: Complemental strand, 84645 - 84592
Alignment:
| Q |
101 |
cacatacatttgccttttgaatgcttttcatgtt-gcatgcatatgtctttcaa |
153 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
84645 |
cacattcatttgctttttgaatgcttttcatgttggcatgcatatgtctttcaa |
84592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University