View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_380 (Length: 230)
Name: NF9913A_low_380
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_380 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 9378169 - 9377940
Alignment:
| Q |
1 |
ttattataatgtttccccttctatgtcgttgttaataaagcaggagaaacgtcaaagagaggaggagcatctaaatgtagcaacaataggacatcatcct |
100 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9378169 |
ttattatattgtttccccttctatgccgttgttaataaagcaggagaaacgtcaaagagaggaggagcatctaaatgtagcaacaataggacatcatcct |
9378070 |
T |
 |
| Q |
101 |
tctttttgtggtggagcaatgagaatcagaaatctcacattgtttagaaaagtaaactttgagcaagaaaaattcagattgtgatgggatccataaactc |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9378069 |
tctttttatggtggagcaatgagaatcagaaatctcacattgtttagaaaagtaaactttgagcaagaataattcagattgtgatgggatccataaactc |
9377970 |
T |
 |
| Q |
201 |
aatggtttaagattttggataaagatatga |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9377969 |
aatggtttaagattttggataaagatatga |
9377940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University