View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_390 (Length: 229)
Name: NF9913A_low_390
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_390 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 18165163 - 18165391
Alignment:
| Q |
1 |
ttgctattgtgggctatgataattattagcatacccctttttatatcctagccgttgagactatatgattaaattttccatcattaggtatataaaaaat |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||||||||||| | |||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
18165163 |
ttgctaatgtgggctatgataattattagcataaccctttttatatcctagctggtgagactatatgattaaagtttccatcattaggtatatagaaaat |
18165262 |
T |
 |
| Q |
101 |
gcgcatggttttaagaatcagtcattgttcttttgttggagacaaccactgtcagttaaagggtatgatgttttcttctaaccttgaatttcataggtgg |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18165263 |
gcgcatggttttaagaatcattcattgttcttttgttggagacaaccactgtcagttaaagggtatgatgttttcttctaaccttgaatttcataggtgg |
18165362 |
T |
 |
| Q |
201 |
ttgtgattaaattaatgtgttgattctga |
229 |
Q |
| |
|
|||||||||||||||||| |||||||||| |
|
|
| T |
18165363 |
ttgtgattaaattaatgttttgattctga |
18165391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University