View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_397 (Length: 228)
Name: NF9913A_low_397
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_397 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 76 - 228
Target Start/End: Original strand, 4232230 - 4232382
Alignment:
| Q |
76 |
taaggaaattaacggtaaactatcaattgatcaagacacaaggataaagacatgtgtcttaaaatcacaaatgatcagccattcagagtttcaaacaata |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4232230 |
taaggaaattaacggtaaactatcaattgatcaagacacaaggataaagacatgtgtcttaaaatcacaaatgatcagccattcagagtttcaaacaata |
4232329 |
T |
|
| Q |
176 |
aattaatttattaaatacgagcaacaacagcaacattctgatacatacttcat |
228 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4232330 |
aattaatttattaaataagagcaacaacagcaacattctgatacatacttcat |
4232382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University