View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_403 (Length: 227)
Name: NF9913A_low_403
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_403 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 31699039 - 31699265
Alignment:
| Q |
1 |
gttatgaggtatggtaggaacttattaagggtggcatggggaatataattagattgcagatgaacggagtctgttgataggtatacagcaatgtaaaaac |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31699039 |
gttatgaggtagggtaggaacttattaagtgtggcatggggaatataattagattgctgatgaacggagtctgttgataggtatacagcaatgcaaaaac |
31699138 |
T |
|
| Q |
101 |
tgaaatcccattaggaaagcggtatggaggagggatgggcaagtagagttagacccttttatactatttgtcgatttatattcaaccaaaccattttggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
31699139 |
tgaaatcccattaggaaagcggtatggaggagggatgggcaagtagagttagacccttttatactatttgtcaatttattttcaaccaaaccattttggt |
31699238 |
T |
|
| Q |
201 |
tagatgtgctagtcaatctatggatga |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31699239 |
tagatgtgctagtcaatctatggatga |
31699265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University