View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_405 (Length: 226)
Name: NF9913A_low_405
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_405 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 28551121 - 28550896
Alignment:
| Q |
1 |
aagattatcacctgtgaaaagagatcatgtcttatgtgcaagaatgagtctacgaacgatccaacaagacaaccatctgggatcttagaggaaattcgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28551121 |
aagattatcacctgtgaaaagagatcatgtcttatgtgcaagaatgagtctacgaacgatccaacaagacaaccatctgggatcttagaggaaattcgca |
28551022 |
T |
|
| Q |
101 |
attggcgtgaagatgagatagagtctctagcacattaattcatttttattgaaatgtgtttaatatggcatgaaccttgtgatttttaaacatcaataat |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28551021 |
attggcgtgaagatgagatagattctctagcacattaattcagttttattgaaatgtgtttaatatggcatgaaccttgtgatttttaaacatcaataat |
28550922 |
T |
|
| Q |
201 |
acttcactttcctttttgttgggacg |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
28550921 |
acttcactttcctttttgttgggacg |
28550896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University