View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_412 (Length: 225)
Name: NF9913A_low_412
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_412 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 23188293 - 23188482
Alignment:
| Q |
18 |
aaataaaattcaaaaagaaaaccaaatttagtttcgtagctgatacaaattgcaaaaggtcatagcatcaaatat--atattaacaaaattcattttgaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23188293 |
aaataaaattcaaaaagaaaaccaaatttagtttcgtagctgatgcaaattgcaaaaggtcatagcatcaaatatatatattaacaaaattcattttgaa |
23188392 |
T |
|
| Q |
116 |
aaattgtcaaactcttgtttctgcgttgtgcttttctcggttctatgaggtgcttcgtgcacaaacaatgtatagcagattgtgtcatct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23188393 |
aaattgtcaaactcttgtttctgcgttgtgcttttctcggttctatgaggtgcttcgtgcacaaacaatgtatagcagattgtgtcatct |
23188482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University