View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_414 (Length: 224)
Name: NF9913A_low_414
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_414 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 11 - 224
Target Start/End: Complemental strand, 39696011 - 39695798
Alignment:
| Q |
11 |
gatggacatcagatttagtgatttacattgtgatggggacaattatagtaggcttcaaagtcctaagtcgtcattgggggtcaaaagaaagactaagctg |
110 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39696011 |
gatgtacataagatttagtgatttacattgtgatggggacaattatagtaggcttcaaagtcctaagtcgtcattgggggtcaaaagaaagactaagctg |
39695912 |
T |
 |
| Q |
111 |
cctgggagttgtaaagctgcaggatagtggcagttgtacgtcctatagtgtttgtgaaggcactgatacagtggggtgaagaaccagggggtgtgaattg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
39695911 |
cctgggagttgtaaagctgcaggatagtggcagttgtacgtcctatagtgtttgtgaaggcactgatacagtgggttgaagaaccaggggttgtgaattg |
39695812 |
T |
 |
| Q |
211 |
cagtgaacaccaaa |
224 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
39695811 |
tagtgaactccaaa |
39695798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University