View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_420 (Length: 224)
Name: NF9913A_low_420
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_420 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 26 - 224
Target Start/End: Complemental strand, 33336807 - 33336608
Alignment:
| Q |
26 |
ctggtaaatgtgactgctgtgagtgagacttaagggtcgggattatcataagtcgtagtagaattttcaggtccaggagtgtcaggtt-atggatgaaag |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33336807 |
ctggtaaatgtgactgctgtgagtgagacttaagggtcgggattatcataagtcgtagtagaattttcaggtccaggagtgtcaggttcatggatgaaag |
33336708 |
T |
 |
| Q |
125 |
tttctggttgtaaatggacattttcaagaactggttggggagcaggttgtatattaattgcattgtcaggtgtggcatgaacatgtggaaagcgggtgtg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33336707 |
tttctggttgtaaatggacattttcaagaactggttggggagcaggttgtatattaattgcattgtcaggtgtggcatgaacatgtggaaagcgggtgtg |
33336608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University