View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_427 (Length: 222)
Name: NF9913A_low_427
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_427 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 23 - 180
Target Start/End: Complemental strand, 11910850 - 11910694
Alignment:
| Q |
23 |
ggagttatgtatttaaaatgtggaatatgtcacagtaacccaattcataaatatcttatgctgatgtattttctgtacgtacgttgtgttccagtaattg |
122 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| | |
|
|
| T |
11910850 |
ggagttatgcatttaaaatgtggaatatgtcacagtaacccaattcataaatatcttatgctgatgtattttttgtgcgtacgttgtgttccagtaatcg |
11910751 |
T |
|
| Q |
123 |
tgttgtagcgttgcagcattccagaaatcgtgttccagtcgtccaccgtcgttctctc |
180 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11910750 |
tgttgtagcattgcagcattccagaaatcgtgttcca-tcgtccaccgtcgttctctc |
11910694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 49 - 136
Target Start/End: Complemental strand, 15513821 - 15513734
Alignment:
| Q |
49 |
atgtcacagtaacccaattcataaatatcttatgctgatgtattttctgtacgtacgttgtgttccagtaattgtgttgtagcgttgc |
136 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||| ||||||||||||| | ||||||||||||||||||| ||| || |||||||| |
|
|
| T |
15513821 |
atgtcacaccaatccaattcataaatatcttatgctaatgtattttctgtgcatacgttgtgttccagtaatcgtgctgcagcgttgc |
15513734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University